As of 28 August, 2024 the dru database contains 103 dru repeats and 579 dru types with from 1 to 23 repeats.
Click here to go to the search page.
BACKGROUND:
Variable-number tandem repeat (VNTR) sequences have found important use in the epidemiological typing of problem bacterial pathogens. In methicillin-resistant Staphylococcus aureus (MRSA), the direct-repeat unit (dru) VNTR region adjacent to IS431 in SCCmec has proved useful in the epidemiological analysis of highly uniform epidemic strains (e.g., EMRSA15 and -16) and in tracking the horizontal movement of SCCmec. Efficient use of dru typing has been facilitated by a uniform system of nomenclature. However, optimum use of this typing approach requires a convenient means where newly generated data can be cataloged and compared in an internationally shared database.
Initial publication of the typing approach and nomenclature can be found at:
Goering, R. V., D. Morrison, Z. Al-Doori, G. F. Edwards, and C. G. Gemmell. 2008. Usefulness of mec-associated direct repeat unit (dru) typing in the epidemiological analysis of highly clonal methicillin-resistant Staphylococcus aureus in Scotland. Clin.Microbiol.Infect. 14:964-969.
“Sanger” sequencing PCR conditions:
forward primer 5’ GTTAGCATATTACCTCTCCTTGC 3’
reverse primer 5’ GCCGATTGTGCTTGATGAG 3’
Initial denaturation step at 94°C for 2 min followed by 30 cycles of 94°C for 1 min, 52°C for 1 min, and 72°C for 1 min.
Whole Genome Sequencing: (see below)
QUERYING THE DATABASE:
The search page of the drutyping.org website allows investigators to enter user generated 40-bp repeat sequences which are then searched against the current database of dru repeats (dr) and identified, if known. Specific combinations of repeats separated by dashes (e.g., 5a-2d-3b-4e) may also be queried against the database and, if recognized, the resulting dru type (dt) will be identified. Click here to go to the search page.
Investigators may also click here to download text files containing the a summary of dru types and dru repeats to facilitate comparison with new data.
ADDITION OF NEW ENTRIES TO THE DATABASE:
New dru repeat and/or dru type data can be submitted online for verification and inclusion into the database.
Sanger sequencing: trace files (.ab1) of both forward and reverse sequences for new dru-repeat (dr) or dru-type (dt) data should be submitted by email to: rgoeri “at” creighton.edu. Upon verification, the new entries will be added to the existing database.
Whole genome sequencing (WGS): WGS presents challenges due to potential sequence alignment and assembly issues posed by the 40-bp tandem repeats. Email rgoeri “at” creighton.edu for submission of sequences. It is important to note that for both Sanger and WGS generated sequences, proper recognition of the dru region is facilitated by insuring that the conserved 5′ (GATTATACTA) and 3′ (ATAAGG/AGGTACAGAAAAACT) sequences are present.
Questions regarding the submission of sequences or other questions, comments, or suggestions may also be emailed to: rgoeri “at” creighton.edu
AUTOMATED DRU TYPING:
Working with dru repeat sequences manually can be a challenge. This can be dramatically simplified for those laboratories having access to newer versions of BioNumerics using the TRST-Tandem Repeat Sequence Analysis plugin which will identify dr and dt sequences directly from .ab1 files. For more information regarding use of BioNumerics and the TRST plugin for automated dru type analysis email rgoeri “at” creighton.edu.
ADDITIONAL SELECTED REFERENCES:
Krüger-Haker H, Ji X, Hanke D, Fiedler S, Feßler AT, Jiang N, Kaspar H, Wang Y, Wu C, Schwarz S. 2023. Genomic diversity of methicillin-resistant Staphylococcus aureus CC398 isolates collected from diseased swine in the German National Resistance Monitoring Program GERM-Vet from 2007 to 2019. Microbiol Spectr. Jun 15;11(3):e0077023. doi: 10.1128/spectrum.00770-23. Epub 2023 May 8. PMID: 37154741; PMCID: PMC10269607
Zhou W, Niu D, Gao S, Zhong Q, Liu C, Liao X, Cao X, Zhang Z, Zhang Y, Shen H. 2023. Prevalence, biofilm formation, and mass spectrometric characterization of linezolid-resistant Staphylococcus capitis isolated from a tertiary hospital in China. J Glob Antimicrob Resist. 33:155-163.
Latifpour M, Goering RV, Havaei SA, Narimani T, Damavandi MS, Sadeghi A, Niakan M.2022. Identification of two major direct repeat unit clusters, 8i and 11ce, among methicillin resistant Staphylococcus aureus strains: the emergence of novel dru types and repeats. Mol Biol Rep 49:8229-8239.
Motallebi M, Alibolandi Z, Aghmiyuni ZF, van Leeuwen WB, Sharif MR, Moniri R.2021. Molecular analysis and the toxin, MSCRAMM, and biofilm genes of methicillin-resistant Staphylococcus aureus strains isolated from pemphigus wounds: A study based on SCCmec and dru typing. Infect Genet Evol 87:104644
Ogundipe FO, Ojo OE, Fessler AT, Hanke D, Awoyomi OJ, Ojo DA, Akintokun AK, Schwarz S, Maurischat S.2020. Antimicrobial Resistance and Virulence of Methicillin-Resistant Staphylococcus aureus from human, chicken and environmental samples within live bird markets in three Nigerian cities. Antibiotics (Basel) 9.
Asanin J, Misic D, Aksentijevic K, Tambur Z, Rakonjac B, Kovacevic I, Spergser J, Loncaric I.2019. Genetic profiling and comparison of human and animal methicillin-resistant Staphylococcus aureus (MRSA) isolates from Serbia. Antibiotics (Basel) 8.
Kittler S, Seinige D, Meemken D, Muller A, Wendlandt S, Ehricht R, Monecke S, Kehrenberg C.2019. Characteristics of methicillin-resistant Staphylococcus aureus from broiler farms in Germany are rather lineage- than source-specific. Poult Sci 98:6903-6913.
Loncaric I, Lepuschitz S, Ruppitsch W, Trstan A, Andreadis T, Bouchlis N, Marbach H, Schauer B, Szostak MP, Fessler AT, Kunzel F, Licka T, Springer B, Allerberger F, Monecke S, Ehricht R, Schwarz S, Spergser J.2019. Increased genetic diversity of methicillin-resistant Staphylococcus aureus (MRSA) isolated from companion animals. Vet Microbiol 235:118-126
Motallebi M, Jabalameli F, Beigverdi R, Emaneini M.2019. High prevalence of direct repeat unit types of 10di, 8 h and 8i among methicillin resistant Staphylococcus aureus strains with staphylococcal cassette chromosome mec type IIIA isolated in Tehran, Iran. Antimicrob Resist Infect Control 8:50.
Soimala T, Lubke-Becker A, Schwarz S, Fessler AT, Huber C, Semmler T, Merle R, Gehlen H, Eule JC, Walther B.2018. Occurrence and molecular composition of methicillin-resistant Staphylococcus aureus isolated from ocular surfaces of horses presented with ophthalmologic disease. Vet Microbiol 222:1-6.
Schauer, B., R. Krametter-Frotscher, F. Knauer, R. Ehricht, S. Monecke, A. T. Fessler, S. Schwarz, T. Grunert, J. Spergser, and I. Loncaric. 2018. Diversity of methicillin-resistant Staphylococcus aureus (MRSA) isolated from Austrian ruminants and New World camelids. Vet.Microbiol. 215:77-82.
Fan, R., D. Li, A. T. Fessler, C. Wu, S. Schwarz, and Y. Wang. 2017. Distribution of optrA and cfr in florfenicol-resistant Staphylococcus sciuri of pig origin. Vet.Microbiol. 210:43-48.
Kang, J. H., T. H. Chung, and C. Y. Hwang. 2017. Clonal distribution of methicillin-resistant Staphylococcus pseudintermedius isolates from skin infection of dogs in Korea. Vet.Microbiol. 210:32-37.
Saab, M. E., J. S. Weese, and J. T. McClure. 2017. Direct repeat unit (dru) typing and antimicrobial resistance of methicillin-resistant Staphylococcus pseudintermedius isolated from dogs in Atlantic Canada. Can.J Vet.Res. 81:192-198.
Muller, A., D. Seinige, W. Jansen, G. Klein, R. Ehricht, S. Monecke, and C. Kehrenberg. 2016. Variety of antimicrobial resistances and virulence factors in Staphylococcus aureus isolates from meat products legally and illegally introduced to Germany. PLoS.One. 11:e0167864.
Fan, R., D. Li, Y. Wang, T. He, A. T. Fessler, S. Schwarz, and C. Wu. 2016. Presence of the optrA gene in methicillin-resistant Staphylococcus sciuri of porcine origin. Antimicrob.Agents Chemother. 60:7200-7205.
Kadlec, K., S. Weiss, S. Wendlandt, S. Schwarz, and W. Tonpitak. 2016. Characterization of canine and feline methicillin-resistant Staphylococcus pseudintermedius (MRSP) from Thailand. Vet.Microbiol. 194:93-97.
Groves, M. D., B. Crouch, G. W. Coombs, D. Jordan, S. Pang, M. D. Barton, P. Giffard, S. Abraham, and D. J. Trott. 2016. Molecular epidemiology of methicillin-resistant Staphylococcus aureus isolated from Australian veterinarians. PLoS.One. 11:e0146034.
Butin, M., J. P. Rasigade, P. Martins-Simoes, H. Meugnier, H. Lemriss, R. V. Goering, A. Kearns, M. A. Deighton, O. Denis, A. Ibrahimi, O. Claris, F. Vandenesch, J. C. Picaud, and F. Laurent. 2016. Wide geographical dissemination of the multiresistant Staphylococcus capitis NRCS-A clone in neonatal intensive-care units. Clin.Microbiol.Infect. 22:46-52
McManus, B. A., D. C. Coleman, E. C. Deasy, G. I. Brennan, B. O’ Connell, S. Monecke, R. Ehricht, B. Leggett, N. Leonard, and A. C. Shore. 2015. Comparative genotypes, staphylococcal cassette chromosome mec (SCCmec) genes and antimicrobial resistance amongst Staphylococcus epidermidis and Staphylococcus haemolyticus isolates from infections in humans and companion animals. PLoS.One. 10:e0138079.
Kadlec, K., S. Schwarz, R. V. Goering, and J. S. Weese. 2015. Direct repeat unit (dru) typing of methicillin-resistant Staphylococcus pseudintermedius from dogs and cats. J.Clin.Microbiol. 53:3760-3765.
Monecke, S., G. W. Coombs, J. Pearson, H. Hotzel, P. Slickers, and R. Ehricht. 2015. A clonal complex 12 methicillin-resistant Staphylococcus aureus strain, West Australian MRSA-59, harbors a novel pseudo-SCCmec element. Antimicrob.Agents Chemother. 59:7142-7144.
Li, D., C. Wu, Y. Wang, R. Fan, S. Schwarz, and S. Zhang. 2015. Identification of multiresistance gene cfr in methicillin-resistant Staphylococcus aureus from pigs: plasmid location and integration into a staphylococcal cassette chromosome mec complex. Antimicrob.Agents Chemother. 59:3641-3644.
Siak, M., A. K. Burrows, G. W. Coombs, M. Khazandi, S. Abraham, J. M. Norris, J. S. Weese, and D. J. Trott. 2014. Characterization of meticillin-resistant and methicillin-susceptible isolates of Staphylococcus pseudintermedius from cases of canine pyoderma in Australia. J.Med.Microbiol. 63:1228-1233.
Wendlandt, S., K. Kadlec, A. T. Fessler, D. E. van, and S. Schwarz. 2014. Two different erm(C)-carrying plasmids in the same methicillin-resistant Staphylococcus aureus CC398 isolate from a broiler farm. Vet.Microbiol. doi:S0378-1135(14)00031-5
Scharn, C.R., F.C. Tenover, and R.V. Goering. 2013. Transduction of staphylococcal cassette chromosome mec elements between strains of Staphylococcus aureus. Antimicrob. Agents Chemother. 57:5233-5238.
Wendlandt, S., K. Kadlec, A. T. Fessler, D. Mevius, A. van Essen-Zandbergen, P. D. Hengeveld, T. Bosch, L. Schouls, S. Schwarz, and D. E. van. 2013. Transmission of methicillin-resistant Staphylococcus aureus isolates on broiler farms. Vet.Microbiol. 167:632-637.
Couto N., A. Belas, P. Tilley, I. Couto, L.T. Gama, K. Kadlec, S. Schwarz, and C. Pomba. 2013. Biocide and antimicrobial susceptibility of methicillin-resistant staphylococcal isolates from horses. Vet Microbiol. 166:299-303
Weiss S., K. Kadlec, A.T. Fessler, and S. Schwarz. 2013. Identification and characterization of methicillin-resistant Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus and Staphylococcus pettenkoferi from a small animal clinic. Vet. Microbiol. 167:680-685.
Perreten, V., P. Chanchaithong, N. Prapasarakul, A. Rossano, S. Blum, D. Elad, and S. Schwendener. 2013. Novel pseudo SCCmec element ({Psi}SCCmec57395) in methicillin-resistant Staphylococcus pseudintermedius CC179. Antimicrob. Agents Chemother. 57:5509-5515.
Wendlandt, S., K. Kadlec, A. T. Fessler, S. Monecke, R. Ehricht, A. W. van de Giessen, P. D. Hengeveld, X. Huijsdens, S. Schwarz, and D. E. van. 2013. Resistance phenotypes and genotypes of methicillin-resistant Staphylococcus aureus isolates from broiler chickens at slaughter and abattoir workers. J.Antimicrob.Chemother. 68:2458-2463.
El-Mahdy, T. S., M. El-Ahmady, and R. V. Goering. 2013. Molecular characterization of methicillin-resistant Staphylococcus aureus isolated over a 2-year period in a Qatari hospital from multinational patients. Clin.Microbiol.Infect. 20:169-173.
Wan, M.T., T.L. Lauderdale, N. Kobayashi, N. Urushibara, and C.C. Chou. 2013. Population deviation of piggery-associated methicillin-resistant Staphylococcus aureus based on mec-associated direct repeat analysis. Infect. Genet. Evol. 16:349-354.
Bartels, M.D., K. Boye, D.C. Oliveria, P. Worning, R.V. Goering, and H. Westh. 2013. Associations between dru types and SCCmec cassettes. PLoS One. 8(4):e61860. doi: 10.1371/journal.pone.0061860.
Fossum Moen, A.E., T.M. Tannaes, and T.M. Leegaard. 2013. USA300 methicillin-resistant Staphylococcus aureus in Norway. APMIS. 121:1091-1096
Himsworth C.G., D.M. Patrick, K. Parsons, A. Feng, and J.S. Weese. 2013. Methicillin-resistant Staphylococcus pseudintermedius in rats. Emerg.Infect.Dis. 19:169-170.
Kinnevey, P.M., A.C. Shore, G.I. Brennan, D.J. Sullivan, R. Ehricht, S. Monecke, P. Slickers, and D.C. Coleman. 2013. Emergence of seuqence type 779 methicillin-resistant Staphylococcus aureus harboring a novel pseudo Staphylococcal Cassette Chromosome mec (SCCmec)-SCC-SCCcrispr composite element in Irish hospitals. Antimicrob. Agents Chemother. 57:524-531.
Monecke, S., A. Ruppelt, S. Wendlandt, S. Schwarz, P. Slickers, R. Ehricht, and S. C. Jackel. 2013. Genotyping of Staphylococcus aureus isolates from diseased poultry. Vet.Microbiol. 162:806-812.
Weese, J. S., K. Sweetman, H. Edson, and J. Rousseau. 2013. Evaluation of minocycline susceptibility of methicillin-resistant Staphylococcus pseudintermedius. Vet.Microbiol. 162:968-971.
Coombs, G. W., R. V. Goering, K. Y. Chua, S. Monecke, B. P. Howden, T. P. Stinear, R. Ehricht, F. G. O’Brien, and K. J. Christiansen. 2012. The molecular epidemiology of the highly virulent ST93 Australian community Staphylococcus aureus strain. PLoS.One. 7:e43037. doi:10.1371/journal.pone.0043037.
Creamer, E., A. C. Shore, A. S. Rossney, A. Dolan, O. Sherlock, D. Fitzgerald-Hughes, D. J. Sullivan, P. M. Kinnevey, P. O’Lorcain, R. Cunney, D. C. Coleman, and H. Humphreys. 2012. Transmission of endemic ST22-MRSA-IV on four acute hospital wards investigated using a combination of spa, dru and pulsed-field gel electrophoresis typing. Eur.J.Clin.Microbiol.Infect.Dis. 31:3151-3161.
Dhanoa, A., V. A. Singh, A. Mansor, M. Y. Yusof, K. T. Lim, and K. L. Thong. 2012. Acute haematogenous community-acquired methicillin-resistant Staphylococcus aureus osteomyelitis in an adult: Case report and review of literature. BMC.Infect.Dis. 12:270. doi:1471-2334-12-270 [pii];10.1186/1471-2334-12-270 [doi].
Julian, T. A. Singh, J. Rousseau, and J. S. Weese. 2012. Methicillin-resistant staphylococcal contamination of cellular phones of personnel in veterinary teaching hospital. BMC Res.Notes. 5: 193. doi:10.1186/1756-0500-5-193
Lim, K. T., Y. A. Hanifah, M. Y. Yusof, R. V. Goering, and K. L. Thong. 2012. Temporal changes in the genotypes of methicillin-resistant Staphylococcus aureus strains isolated from a tertiary Malaysian hospital based on MLST, spa, and mec-associated dru typing. Diagn.Microbiol.Infect.Dis. 74:106-112.
Manoharan, A., L. Zhang, A. Poojary, L. Bhandarkar, G. Koppikar, and D. A. Robinson. 2012. An outbreak of post-partum breast abscesses in Mumbai, India caused by ST22-MRSA-IV: genetic characteristics and epidemiological implications. Epidemiol.Infect. 140:1809-1812.
Wang, S.-H., K. Yosef, L. Hines, J.R. Mediavilla, L. Zhang, L. Chen, A. Hoet, T. Bannerman, P. Pancholi, D. Ashley Robinson, B.N. Kreiswirth, and K.B. Stevenson. 2012. Methicillin-resistant Staphylococcus aureus type 239-III, Ohio, USA, 2007-2009. Emerg.Infect.Dis. 18:1557-1565.
Ghaznavi-Rad, E., R. V. Goering, S. M. Nor, P. L. Weng, Z. Sekawi, M. Tavakol, B. A. van, and V. Neela. 2011. mec-associated dru typing in the epidemiological analysis of ST239 MRSA in Malaysia. Eur.J.Clin.Microbiol.Infect.Dis. 30:1365-1369.
Smyth, D. S., A. Wong, and D. A. Robinson. 2011. Cross-species spread of SCCmec IV subtypes in staphylococci. Infect.Genet.Evol. 11:446-453.Fessler, A., C. Scott, K. Kadlec, R. Ehricht, S. Monecke, and S. Schwarz. 2010. Characterization of methicillin-resistant Staphylococcus aureus ST398 from cases of bovine mastitis. J.Antimicrob.Chemother. 65:619-625.
Ionescu, R., J. R. Mediavilla, L. Chen, D. O. Grigorescu, M. Idomir, B. N. Kreiswirth, and R. B. Roberts. 2010. Molecular characterization and antibiotic susceptibility of Staphylococcus aureus from a multidisciplinary hospital in Romania. Microb.Drug Resist. 16:263-272.
Shore, A. C., A. S. Rossney, P. M. Kinnevey, O. M. Brennan, E. Creamer, O. Sherlock, A. Dolan, R. Cunney, D. J. Sullivan, R. V. Goering, H. Humphreys, and D. C. Coleman. 2010. Enhanced discrimination of highly clonal ST22-methicillin-resistant Staphylococcus aureus IV isolates achieved by combining spa, dru, and pulsed-field gel electrophoresis typing data. J.Clin.Microbiol. 48:1839-1852.
Smyth, D. S., L. K. McDougal, F. W. Gran, A. Manoharan, M. C. Enright, J. H. Song, L. H. de, and D. A. Robinson. 2010. Population structure of a hybrid clonal group of methicillin-resistant Staphylococcus aureus, ST239-MRSA-III. PLoS.One. 5:e8582. doi:10.1371/journal.pone.0008582 [doi].